Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question

Author:Mary Jones, Richard Fosbery, Dennis Taylor & Jennifer Gregory

Mary Jones Biology Solutions for Exercise - Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question

Attempt the practice questions on Chapter 19: Genetic Technology, Exercise 7: Question with hints and solutions to strengthen your understanding. Biology for Cambridge International AS & A Level coursebook 2nd Edition Digital Access solutions are prepared by Experienced Embibe Experts.

Questions from Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question with Hints & Solutions

HARD
AS and A Level
IMPORTANT

State the base sequence of gRNA that is required to edit a section of DNA with the base sequence: AAATTTCGCTCAGCCTTCCC

HARD
AS and A Level
IMPORTANT

Explain the advantage of using Crispr/Cas9 over using restriction enzymes.

HARD
AS and A Level
IMPORTANT

Describe how Crispr/Cas9 can be used to correct a genetic fault.