Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question
Author:Mary Jones, Richard Fosbery, Dennis Taylor & Jennifer Gregory
Mary Jones Biology Solutions for Exercise - Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question
Attempt the practice questions on Chapter 19: Genetic Technology, Exercise 7: Question with hints and solutions to strengthen your understanding. Biology for Cambridge International AS & A Level coursebook 2nd Edition Digital Access solutions are prepared by Experienced Embibe Experts.
Questions from Mary Jones, Richard Fosbery, Dennis Taylor and, Jennifer Gregory Solutions for Chapter: Genetic Technology, Exercise 7: Question with Hints & Solutions
HARD
AS and A Level
IMPORTANT
State the base sequence of gRNA that is required to edit a section of DNA with the base sequence: AAATTTCGCTCAGCCTTCCC

HARD
AS and A Level
IMPORTANT
Explain the advantage of using Crispr/Cas9 over using restriction enzymes.

HARD
AS and A Level
IMPORTANT
Describe how Crispr/Cas9 can be used to correct a genetic fault.
