Tamil Nadu Board Solutions for Exercise 1: Evaluation
Tamil Nadu Board Biology-Zoology Solutions for Exercise - Tamil Nadu Board Solutions for Exercise 1: Evaluation
Attempt the free practice questions from Exercise 1: Evaluation with hints and solutions to strengthen your understanding. Biology Zoology Standard 12 solutions are prepared by Experienced Embibe Experts.
Questions from Tamil Nadu Board Solutions for Exercise 1: Evaluation with Hints & Solutions
HGP is the windows for treatment of various genetic disorders. Justify the statement.
Write the source of energy for the replication and name the enzyme involved in this process.
Mention the differences in the synthesis of protein, based on the polarity of the two template strands of DNA.
If the coding sequence in a transcription unit is written as follows:
5’ TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
How is the two stage process of protein synthesis advantageous?
Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?
Explain the formation of a nucleosome.
It is established that RNA is the first genetic material. Justify giving reasons.
