HARD

Earn 100

A linear double-stranded DNA was completely digested using either one or two restriction endonucleases ( $Cfr 10 I$ and $Ban II$ ). The sequence of one of the strands is provided. The restriction site for $Cfr 10 I$ is $RCCGGY$ and for $BanII$ is $GRGCYC$ ( $R$ is $A$ or $G$ and $Y$ is $T$ or $C$ ).
$5^{'} TGGAGAGACCGGTAGCAGAGAGCTCCATTCCGGGCGCGCCGGCACCCTTAGGA 3^{'}$
Based on this information, the correct option is

50% studentsanswered this correctly

Important Questions on Biotechnology : Principles and Processes

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Identify the palindromic sequence.

HARD

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to produce 3000 bp and 2000 bp bands when visualised on an agarose gel. When digested with one enzyme at a time, only one band is visible at 5000 bp. If the first site for enzyme A (A₁) is present at the 100th base, the order in which the remaining sites (A₂, B₁, and B₂) are present is:

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Following statements describe the characteristics of restriction endonucleases. Identify the incorrect statement.

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Select the correct statement from the following:

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Restriction enzyme work by cleaving

MEDIUM

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Identify the wrong statement with regard to restriction enzymes.

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Which one of the following represents a palindromic sequence in DNA?

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Identify the palindromic sequence in the following base sequences

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

How many linear DNA fragments will be produced when a circular plasmid is digested with a restriction enzyme having 3 sites?

HARD

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

A scientist has cloned an 8 Kb fragment of a mouse gene into the Eco RI site of a vector of 6 Kb size. The cloned DNA has no other Eco RI site within. Digestions of the cloned DNA is shown below

Question Image

Which one of the following sets of DNA fragments generated by digestion with both Eco RI and Bam HI as shown in (iii) is from the gene?

MEDIUM

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

In a restriction enzyme digestion experiment, a

DNA

fragment of

1

kilobases length is used. This fragment harbors three

5^{'} - GAATTC - 3^{'}

restriction sites. After the restriction digestion of this fragment with EcoRI,

3 DNA

fragments corresponding to

500, 300 & 100

base pairs are observed in the agarose gel electrophoresis

(AGE)

. Predict the positions of the restriction site

(GAATTC)

in the undigested

1 kb

-fragment which will result in the observed bands in

AGE

MEDIUM

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Which ONE of the following statements is INCORRECT about restriction endonucleases?

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Study the following lists:

	List- $I$		List- $II$
A.	Eco RI	$I .$	Vector for transgenic plants
B.	Ti plasmid	$II .$	Restriction enzyme
C.	pBR $322$	$III .$	Probe
D.	Reverse transcriptase	$IV .$	RNA dependent DNA synthesis
		$V .$	Artificial plasmid

The correct match is

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Genomic DNA is digested with

Alu I,

a restriction enzyme which is a four base-pair cutter. What is the frequency with which it will cut the DNA assuming a random distribution of bases in the genome?

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Match the following lists:

	List $I$		List $II$
A)	Hind $II$	$I)$	pBR $322$
B)	Eco RI	$II)$	Replication of the plasmid
C)	Hind $III$	$III)$	First restriction endonuclease
D)	rop codes	$IV)$	E. coli Ry $13$

The correct match is

MEDIUM

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Identify the

DNA

sequence which can be cut using

EcoRI

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Choose the bacterium which is not a source of

REN

HARD

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Eco

R I

and Rsa

I

restriction endonucleases require 6bp and 4bp sequences respectively for cleavage. In a 10 kb DNA fragment how many probable cleavage sites are present for these enzymes

MEDIUM

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Consider the linear double-stranded DNA shown below. The restriction enzyme sites and the lengths demarcated are shown. This DNA is completely digested with both Eco $R I$ and Bam $H I$ restriction enzymes. If the product is analyzed by gel electrophoresis, how many distinct bands would be observed?

Question Image

EASY

Biology>Biotechnology>Biotechnology : Principles and Processes>Tools of Recombinant DNA Technology

Which of the following is a restriction endonuclease?

Important Questions on Biotechnology : Principles and Processes

Learn and Prepare for any exam you want !