Transcription

During transcription, the template strand is the one with the polarity:

Transcription in prokaryotes differs from that of eukaryotes as the former

What will be the sequence of mRNA produced by the following stretch of DNA?

$$\begin{gathered} 3\text{'}\mathrm{ATGCATGCATGCATG}5\text{'} - \mathrm{Template} \mathrm{strand} \\ 5\text{'}\mathrm{TACGTACGTACGTAC}3\text{'}- \mathrm{Coding} \mathrm{strand} \end{gathered}$$

Which of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows

5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG '3

What is the role of RNA polymerase III in the process of transcription in Eukaryotes? 

The diagram represents the schematic structure of a transcription unit. Choose the correct combination of labelling:

Choose the correct statements from the following.

A) Coding strand in DNA will be coding the m-RNA.

B) If two RNA molecules are produced simultaneously, they will form a double stranded RNA.

C) In prokaryotes, the structural gene is polycistronic.

D) The expressed gene sequences are defined as exons.

If the sequence of bases in DNA is $\mathrm{TGAACCCTT}$, then the sequence of bases in mRNA is:

If the sequence of bases in DNA is TGAACCCTT then the sequence of bases in m-RNA is

If coding strand of DNA has the following sequence, find the last codon to 5'- ATG CCT TTC TAG -3' coding strand incorporate amino acid in mRNA.

A segment of DNA coding for a polypeptide, the structural gene in a transcription unit is called

In eukaryotes, $\mathrm{RNA}$ polymerase $\mathrm{III}$is responsible for synthesis of:

In the process of transcription, the strand of DNA with polarity _____ acts as a _____ strand.

The transcription of any gene is the indication of its

In a transcription unit in a DNA segment, a promoter is located

Select the correct statement:

The base sequence of mRNA is similar to ........................ except for that uracil will be present in place of thymine in mRNA.

Similarity between DNA sequences of two eukaryotic species is used to predict their evolutionary relatedness, pointing to a shared ancestry. In an attempt to evaluate this relatedness, a group of researchers sequenced and compared two proteins with the same function from the two species. The corresponding DNA and RNA sequences were also compared to decipher their relatedness. Based on this information, the correct option is

The most important functions of $\mathrm{mRNA}$ is to