Translation

When ribosome encounters a stop codon in the mRNA, during translation, which one of the following binds to the stop codon? 

Which of the following structures translate mRNA into proteins in a bacterial cell?

Which of the following statements are correct in context of polycistronic mRNA?

(a) Codes for more than one polypeptide.

(b) Commonly found in eukaryotes.

(c) More than one stop codon present.

(d) More than one ribosomes may be attached to such mRNA at same time.

A stretch of mRNA has $282$ nucleotides. What would be the number of amino acids in the sequence if this mRNA is translated?

The process of translation is

'One gene one enzyme' concept was put forward by:

How many nucleotides of DNA are required to code a polypeptide if in an E.coli, a finished polypeptide has $162$ amino acids of which the first amino acid is not a methionine compound?

In a translation experiment, two different $\mathrm{mRNAs}$ with different nucleotide sequences, $\mathrm{mRNA} 1: 5\text{'}\mathrm{AUGUUUUUAUUUUUAUAAUUCUUG}3\text{'}$ and 

$\mathrm{mRNA}2: 5\text{'}\mathrm{AUGUUCUUGUUAUUUUAGUUUUUACUU}3\text{'}$

are used. Which of the following statement is true?

Polysomes translate __________.

During translation process, which structure of protein is produced :-

What will stop if all the ribosomes of a cell are destroyed?

 ___________ is the term used for the movement of ribosome on mRNA.

The following diagram represents translation in bacteria. Identify the incorrect statement with respect to this.

Peptidyl transferase activity is inhibited by which of the following antibiotic?

If a polypeptide chain contains 50 amino acids, in its cistron, what will be the minimum number of nucleotides?

Of the following amino acid which one is sulphur containing?

Which of the following is an incorrect pair pertaining to the translation process?

Which of the following represents charging of tRNA?

Which of the following is the characteristic feature of UTRs in mRNA?

RNA can easily express the character due to: